cfx96 touch real time pcr detection system thermocycler (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
99
Structured Review
Bio-Rad
cfx96 touch real time pcr detection system thermocycler
Cfx96 Touch Real Time Pcr Detection System Thermocycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 20055 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cfx96+real+time+thermocycler/CFX96+Touch/pmc13170971-438-6-13
Average 99 stars, based on 20055 article reviews
Cfx96 Touch Real Time Pcr Detection System Thermocycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 20055 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cfx96+real+time+thermocycler/CFX96+Touch/pmc13170971-438-6-13
Average 99 stars, based on 20055 article reviews
cfx96 touch real time pcr detection system thermocycler - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Real-time Polymerase Chain Reaction:Article Title: Quantitative PCR Analysis of Haemosporidian Infection Intensity in a Temperate Bird Community. Article Snippet: Avian haemosporidians are vector-borne parasites with complex transmission dynamics influenced by host ecology and environmental factors.. Both prevalence and parasitemia are key measures in host–parasite studies.. While prevalence reflects the proportion of infected individuals in a population, parasitemia provides insights into the intensity of infectionwithinhosts, offering a different but complementary perspective. Polymerase Chain Reaction:Article Title: iPSC-derived cerebral organoids reveal mitochondrial, inflammatory and neuronal vulnerabilities in bipolar disorder Article Snippet: .. PCR was performed on a Article Title: Circulation of RSV Subtypes A and B Among Mexican Children During the 2021–2022 and 2022–2023 Seasons Article Snippet: .. Multiplex PCR was performed using a Article Title: Exon skipping oligomer conjugates for muscular dystrophy Article Snippet: PCR was performed by adding 9 μL cDNA into Platinum Taq DNA polymerase PCR Supermix High Fidelity (Cat#12532024, Invitrogen) with primers that targeted human DMD exons 43 and 46 [forward primer (SEQ ID NO. 7): CTACAGGAAGCTCTCTCCCAG; reverse primer (SEQ ID NO. 8): GTTATCTGCTTCCTCCAACCA]. .. PCR amplification was performed using BioRad Concentration Assay:Article Title: iPSC-derived cerebral organoids reveal mitochondrial, inflammatory and neuronal vulnerabilities in bipolar disorder Article Snippet: .. PCR was performed on a Multiplex Assay:Article Title: Circulation of RSV Subtypes A and B Among Mexican Children During the 2021–2022 and 2022–2023 Seasons Article Snippet: .. Multiplex PCR was performed using a Software:Article Title: Circulation of RSV Subtypes A and B Among Mexican Children During the 2021–2022 and 2022–2023 Seasons Article Snippet: .. Multiplex PCR was performed using a Amplification:Article Title: Extracellular Metallothionein: An Alarmin Regulating Lymphocyte Gene Expression, Cell Signaling, and Immune Function. Article Snippet: .. Reactions were amplified in triplicate using a Article Title: Extracellular metallothionein: An alarmin regulating lymphocyte gene expression, cell signaling, and immune function Article Snippet: .. Reactions were amplified in triplicate using a Article Title: Exon skipping oligomer conjugates for muscular dystrophy Article Snippet: PCR was performed by adding 9 μL cDNA into Platinum Taq DNA polymerase PCR Supermix High Fidelity (Cat#12532024, Invitrogen) with primers that targeted human DMD exons 43 and 46 [forward primer (SEQ ID NO. 7): CTACAGGAAGCTCTCTCCCAG; reverse primer (SEQ ID NO. 8): GTTATCTGCTTCCTCCAACCA]. .. PCR amplification was performed using BioRad other:Article Title: E6/E7 Similarity to Human Papillomavirus Prototypes and Performance of HPV Testing by Cobas 4800 HPV Test and Anyplex II HPV HR Article Snippet: The Anyplex assay was performed on a |